🧬 Gene Exon Painter – User Manual

Introduction

Gene Exon Painter is an interactive web-based tool for visualizing exons from multiple transcripts mapped onto a genomic sequence. It helps you:

• Understand transcript structure and exon organization
• Explore alternative splicing
• Identify shared and overlapping exons
• Demonstrate gene architecture in teaching

Installation & Requirements

1. Tool created specifically for gene Ccds33 in Mouse (Mus_musculus.GRCm39.113.gtf.gz and Mus_musculus.GRCm39.dna.chromosome.9.fa.gz).
2. If other genes needed, so make Ensembl download of *.gtf.gz and *.dna.chromosome.9.fa.gz or *.dna.primary_assembly.fa.gz.
3. Run code create_input_files.bash to create input files for Painter. (need to change filenames inside the script)
4. Open index.html in your browser.
5. Upload a genomic sequence file (.txt or .fasta). Here available gene Cdcc33.
6. Upload one or more exon .fasta files. Exon sequence for gene Cdcc33 available here.
7. Select a transcript and highlight its exons.

Instructions for use:

1. Download the "Genomic sequence" file (Ccdc33_gene_str.txt).
2. Download all the "exonsUTRs..." FASTA files.
3. On the Gene Exon Painter page:
   • Click "Choose File" next to "Genomic sequence (.txt/.fasta):" and select the downloaded Ccdc33_gene_str.txt.
   • Click "Choose Files" next to "Exon FASTA files (multiple):" and select all the downloaded exonsUTRs...renamed.fasta files.

• No installation required – just open the HTML file in your browser
• Works offline after loading
• Supported browsers:
  • Chrome (recommended)
  • Firefox
  • Edge
  • Safari (limited)

Input Files

Genomic Sequence

• Format: .fasta, .fa, or .txt
• Must contain one continuous sequence (no line breaks within bases)
• Plain string; headers (>) ignored.
• Must match coordinates used in exon files.

>chr9_mouse
AGTCGATCGATCGTACGTAGCTAGCTAGC...

Exon FASTA Files

• Format: .fasta, .fa (can upload multiple)
• Each entry header should be: >ENSMUST00000000000:TranscriptName:Ex.1
• Sequence must match exactly a region in the genomic sequence

>ENSMUST00000000000:TranscriptName:Ex.1
ATGCGTACTGACGTTAG

Step-by-Step Usage

1. Load Files

• Upload your genomic sequence file using the left panel
• Upload one or more exon FASTA files

2. Select and View Transcripts

• Choose a transcript from the dropdown
• Exons for that transcript will appear below

3. Highlight Exons

• Click exon names in the list or table to highlight their positions
• Multiple exons can be selected
• Overlaps are visualized using color gradients

4. View Details

• Click a base in the sequence to open the related exon
• The panel shows:
  • Exon label, position and sequence
  • Exons with identical sequence
  • Exons overlapping the selected one

Features

• Color-coded exon visualization
• Gradients for overlapping regions
• Clickable base-by-base interaction
• Dynamic dropdowns and filtering
• Detection of identical sequences and overlaps

Error Handling

• Exons not found in the genome are skipped (warning in console)
• Genomes over ~500,000 bp may reduce performance

Known Limitations

• No export functionality (planned)
• No strand/directionality support
• Compressed files (.gz) not supported

Troubleshooting

Exons not showing?

• Check if the exon sequence matches the genomic region exactly
• Ensure the genome file was uploaded first

Colors confusing?

• Each transcript is assigned a unique color
• Overlapping exons show blended gradients
• Hover over bases to see transcript:exon labels

Sequence loaded but nothing appears?

• Inspect the browser console (F12) for loading errors
• Check if sequences match exactly (including case and characters)

Citation & Contact

If you use this tool, please cite the repository or author.

For questions or suggestions, open an issue on GitHub or contact the maintainer.

Example Files

genomic.txt

>GeneXYZ
ATGCGTACTGACGTTAGCTAGCATCGATCGTACGTAGC

exons.fa

>TranscriptA:Exon1
ATGCGTACTGACGTTAG
>TranscriptB:Exon2
CTAGCATCGATCGTACG